Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p-EF1a-CreERT2-3Xflag-T2A-eBFP2
(Plasmid #170186)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170186 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGIR-EF1aFULL-CreERT2-Cterm3xFlag-T2A-eBFP2
  • Backbone manufacturer
    Bernstein Lab
  • Backbone size w/o insert (bp) 7314
  • Total vector size (bp) 10167
  • Vector type
    Lentiviral
  • Selectable markers
    eBFP2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Grow on LB agar plates at 30 degrees, shaking at 37 in LB broth
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CreERT2-T2A-eBFP2
  • Species
    Synthetic
  • Insert Size (bp)
    2853
  • Promoter EF1 alpha

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site xbalI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer -
  • 3′ sequencing primer agctgacaggtggtggcaat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-EF1a-CreERT2-3Xflag-T2A-eBFP2 was a gift from Bradley Bernstein (Addgene plasmid # 170186 ; http://n2t.net/addgene:170186 ; RRID:Addgene_170186)
  • For your References section:

    Parallel Single-Cell RNA-Seq and Genetic Recording Reveals Lineage Decisions in Developing Embryoid Bodies. Kim IS, Wu J, Rahme GJ, Battaglia S, Dixit A, Gaskell E, Chen H, Pinello L, Bernstein BE. Cell Rep. 2020 Oct 6;33(1):108222. doi: 10.1016/j.celrep.2020.108222. 10.1016/j.celrep.2020.108222 PubMed 33027665