pBZ210-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Ec86RT-NLS-T2A-mCherry
(Plasmid #170185)

• Purpose: Expression vector for a sgRNA against BFP and spCas9-Ec86 RT fusion protein linked to mCherry via a T2A peptide. Donor template An was inserted in the Retron Ec86 msr-msd region by SpeI and AvrII.
• Depositing Lab: Hunter Fraser
• Publication: Zhao et al CRISPR J. 2022 Jan 24. doi: 10.1089/crispr.2021.0065.

Backbone

• Vector backbone: pBZ191-pU6-sgBFP-CBh-sv40NLS-Cas9-NLS-T2A-mCherry
• Backbone manufacturer: Fraser lab
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Ec86 RT
• Alt name: RT-Sau1
• Species: Escherichia coli
• Promoter: CBh
• Tag / Fusion Protein:
  • NLS (C terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CACGATATGTCTAAGGCAAC

Gene/Insert 2

• Gene/Insert name: Retron Ec86 msr-msd
• Alt name: Retron Eco1 msr-msd
• Species: Escherichia coli
• Promoter: hU6

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACTATCATATGCTTACCGT
• 3′ sequencing primer: acttgatgtactgccaagtg

Gene/Insert 3

• Gene/Insert name: BFP-to-GFP conversion donor template An
• Promoter: hU6

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACTATCATATGCTTACCGT
• 3′ sequencing primer: acttgatgtactgccaagtg

Resource Information

• Supplemental Documents:
  • pbz210-pu6-sgbfp-an_cbh-sv40nls-cas9-ec86rt-nls-t2a-mcherry.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry