AAV-EFS-GFP
(Plasmid
#170176)
-
PurposeExpresses GFP under the control of EF1a short promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170176 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV vector
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter EFS promoter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gtggactcttgttccaaactgg
- 3′ sequencing primer agggaagaaagcgaaaggag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-EFS-GFP was a gift from Xiaojun Lian (Addgene plasmid # 170176 ; http://n2t.net/addgene:170176 ; RRID:Addgene_170176) -
For your References section:
Direct programming of human pluripotent stem cells into endothelial progenitors with SOX17 and FGF2. Ream MW, Randolph LN, Jiang Y, Chang Y, Bao X, Lian XL. Stem Cell Reports. 2024 Mar 5:S2213-6711(24)00044-4. doi: 10.1016/j.stemcr.2024.02.006. 10.1016/j.stemcr.2024.02.006 PubMed 38518781