MS2-adRNA (RAB7A-GAC site)
(Plasmid
#170140)
-
PurposeAAV vector carrying a MS2 adRNA targeting the RAB7A transcript
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170140 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV
-
Backbone manufacturerCustom
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 6100
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMS2-RAB7A(GAC)-MS2
-
gRNA/shRNA sequenceaACATGAGGATCACCCATGTcTACATAATTCTTGTGCCTACTGTACAGAATaACATGAGGATCACCCATGTc
-
SpeciesH. sapiens (human)
- Promoter Human U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MS2-adRNA (RAB7A-GAC site) was a gift from Prashant Mali (Addgene plasmid # 170140 ; http://n2t.net/addgene:170140 ; RRID:Addgene_170140) -
For your References section:
Comprehensive interrogation of the ADAR2 deaminase domain for engineering enhanced RNA editing activity and specificity. Katrekar D, Xiang Y, Palmer N, Saha A, Meluzzi D, Mali P. Elife. 2022 Jan 19;11. pii: 75555. doi: 10.7554/eLife.75555. 10.7554/eLife.75555 PubMed 35044296