MS2-adRNA (3'GAC)
(Plasmid #170129)

• Purpose: Lentiviral vector carrying 2 copies of the MS2 adRNA targeting a GAC at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125
• Depositing Lab: Prashant Mali
• Publication: Katrekar et al Elife. 2022 Jan 19;11. pii: 75555. doi: 10.7554/eLife.75555.

Backbone

• Vector backbone: lentiCRISPR v2
• Backbone manufacturer: Addgene #52961
• Backbone size w/o insert (bp): 10500
• Total vector size (bp): 12300
• Modifications to backbone: 1 copy of the MS2-adRNA cloned downstream of the human U6 promoter followed by a mouse U6 promoter that drives the expression of a second copy. mCherry-P2A-Hygromycin cloned in place of the Cas9-P2A-Puromycin in the original vector.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MS2-ADAR2(3'GAC)-MS2
• gRNA/shRNA sequence: aACATGAGGATCACCCATGTcGCACAGCCTGCTGGCTCTTCaACATGAGGATCACCCATGTc
• Species: H. sapiens (human)
• Promoter: Human U6 and mouse U6

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACTATCATATGCTTACCGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry