MCP-ADAR2-DD
(Plasmid
#170124)
-
PurposeLentiviral vector carrying the MCP-ADAR2 with a nuclear export signal
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170124 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerAddgene #52961
- Backbone size w/o insert (bp) 10500
- Total vector size (bp) 12300
-
Modifications to backboneMCP-ADAR2-DD-NES cloned in place of the Cas9 in the original vector
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMCP-ADAR2-DD-NES
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1626
- Promoter Ef1a core promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer accgtatataagtgcagtagtcgcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MCP-ADAR2-DD was a gift from Prashant Mali (Addgene plasmid # 170124 ; http://n2t.net/addgene:170124 ; RRID:Addgene_170124) -
For your References section:
Comprehensive interrogation of the ADAR2 deaminase domain for engineering enhanced RNA editing activity and specificity. Katrekar D, Xiang Y, Palmer N, Saha A, Meluzzi D, Mali P. Elife. 2022 Jan 19;11. pii: 75555. doi: 10.7554/eLife.75555. 10.7554/eLife.75555 PubMed 35044296