Skip to main content
Addgene

Circular 200,100 (mPCSK9)
(Plasmid #170122)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170122 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pZac2.1
  • Backbone manufacturer
    Addgene #78601
  • Backbone size w/o insert (bp) 5700
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Circular 200,100 guide RNA
  • gRNA/shRNA sequence
    GCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGCCTAACCATGCCGACTGATGGCAGAAAAAAAAAACTTCCTGAAAGACAAATACACCCTAAGGCCTGAGAACTGAGGCCTTGCAGCGAGCATCCTCAGGTTCTGGTACACTGGAGCAGCTGGCCAGAGCCAGCCACAGCTTAATGTCTGATGGCAGAAAGCCAAGCACAGGCCCCCTGACCGTGAAGGAGGTGCTTCCATACACCAGGAATGGGTACCCAGGGTGAGACACCAAAAAAAAAACTGCCATCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Pcsk9 (a.k.a. AI415265, AI747682, FH3, HCHOLA3, Narc1, PC9)
  • Promoter Human U6 and mouse U6

Cloning Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Circular 200,100 (mPCSK9) was a gift from Prashant Mali (Addgene plasmid # 170122 ; http://n2t.net/addgene:170122 ; RRID:Addgene_170122)
  • For your References section:

    Efficient in vitro and in vivo RNA editing via recruitment of endogenous ADARs using circular guide RNAs. Katrekar D, Yen J, Xiang Y, Saha A, Meluzzi D, Savva Y, Mali P. Nat Biotechnol. 2022 Feb 10. pii: 10.1038/s41587-021-01171-4. doi: 10.1038/s41587-021-01171-4. 10.1038/s41587-021-01171-4 PubMed 35145312