pT7RNAP
(Plasmid
#170101)
-
Purposeexpresses T7 RNAP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 3262
- Total vector size (bp) 6296
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)KL740 cI857+
-
Growth instructions29°C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameT7-RNA polymerase
-
Insert Size (bp)2652
- Promoter p70a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aacgtggcgagaaaggaagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7RNAP was a gift from Chase Beisel (Addgene plasmid # 170101 ; http://n2t.net/addgene:170101 ; RRID:Addgene_170101) -
For your References section:
A TXTL-Based Assay to Rapidly Identify PAMs for CRISPR-Cas Systems with Multi-Protein Effector Complexes. Wimmer F, Englert F, Beisel CL. Methods Mol Biol. 2022;2433:391-411. doi: 10.1007/978-1-0716-1998-8_24. 10.1007/978-1-0716-1998-8_24 PubMed 34985758