Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEc-crRNA2
(Plasmid #170089)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170089 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    ColE1
  • Backbone size w/o insert (bp) 1688
  • Total vector size (bp) 1852
  • Vector type
    CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E. coli type I-E single spacer array
  • gRNA/shRNA sequence
    CGCTGGGCATGCTGAGCTAACACCGTGCGTGT
  • Promoter J23119

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEc-crRNA2 was a gift from Chase Beisel (Addgene plasmid # 170089 ; http://n2t.net/addgene:170089 ; RRID:Addgene_170089)
  • For your References section:

    A TXTL-Based Assay to Rapidly Identify PAMs for CRISPR-Cas Systems with Multi-Protein Effector Complexes. Wimmer F, Englert F, Beisel CL. Methods Mol Biol. 2022;2433:391-411. doi: 10.1007/978-1-0716-1998-8_24. 10.1007/978-1-0716-1998-8_24 PubMed 34985758