WT Ecm2
(Plasmid
#169922)
-
PurposeEcm2 +/-300bp of up- and downstream seq. cloned into the NotI and SalI sites of pRS416
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRS416
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6500
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEcm2
-
Alt nameECM2 / Stl11 URA
-
Alt namepAAH1056
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1500
-
GenBank ID852357
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CGAGGTCGACGATAAATAGTAATAAAACTA AGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
WT Ecm2 was a gift from Aaron Hoskins (Addgene plasmid # 169922 ; http://n2t.net/addgene:169922 ; RRID:Addgene_169922) -
For your References section:
Saccharomyces cerevisiae Ecm2 Modulates the Catalytic Steps of pre-mRNA Splicing. van der Feltz C, Nikolai B, Schneider C, Paulson JC, Fu X, Hoskins AA. RNA. 2021 Feb 5. pii: rna.077727.120. doi: 10.1261/rna.077727.120. 10.1261/rna.077727.120 PubMed 33547186