pLentiCRISPR V2 sgACO1_3
(Plasmid
#169893)
-
PurposeDisrupt ACO1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169893 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLENTICRISPR V2
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 11590
- Total vector size (bp) 11590
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting ACO1
-
SpeciesSynthetic
-
Insert Size (bp)21
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Target: GCTCGCTACTTAACTAACAG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPR V2 sgACO1_3 was a gift from Richard Possemato (Addgene plasmid # 169893 ; http://n2t.net/addgene:169893 ; RRID:Addgene_169893) -
For your References section:
Iron-sulfur cluster deficiency can be sensed by IRP2 and regulates iron homeostasis and sensitivity to ferroptosis independent of IRP1 and FBXL5. Terzi EM, Sviderskiy VO, Alvarez SW, Whiten GC, Possemato R. Sci Adv. 2021 May 26;7(22). pii: 7/22/eabg4302. doi: 10.1126/sciadv.abg4302. Print 2021 May. 10.1126/sciadv.abg4302 PubMed 34039609