pCW57.1 blast OFF 3xflag IREB2
(Plasmid #169889)

• Purpose: Express 3x flag IREB2, suppressible by doxycycline addition
• Depositing Lab: Richard Possemato
• Publication: Terzi et al Sci Adv. 2021 May 26;7(22). pii: 7/22/eabg4302. doi: 10.1126/sciadv.abg4302. Print 2021 May.

Backbone

• Vector backbone: pCW57.1-MAT2A
• Backbone manufacturer: Addgene 100521
• Backbone size w/o insert (bp): 7700
• Total vector size (bp): 10700
• Vector type: Mammalian Expression, Lentiviral ; Doxycycline mediated suppression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: IREB2
• Alt name: Iron Responsive Element Binding Protein 2
• Species: H. sapiens (human)
• Insert Size (bp): 3000
• Mutation: Silent mutations in sgIREB2_1 and sgIREB2_2 target sites
• Entrez Gene: IREB2 (a.k.a. ACO3, IRE-BP 2, IRE-BP2, IRP2, IRP2AD, NDCAMA)
• Promoter: TRE
• Tag / Fusion Protein:
  • 3x Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: AGCTCGTTTAGTGAACCGTCAGATC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry