pCW57.1 blast OFF 3xflag IREB2
(Plasmid
#169889)
-
PurposeExpress 3x flag IREB2, suppressible by doxycycline addition
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169889 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCW57.1-MAT2A
-
Backbone manufacturerAddgene 100521
- Backbone size w/o insert (bp) 7700
- Total vector size (bp) 10700
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline mediated suppression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIREB2
-
Alt nameIron Responsive Element Binding Protein 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3000
-
MutationSilent mutations in sgIREB2_1 and sgIREB2_2 target sites
-
Entrez GeneIREB2 (a.k.a. ACO3, IRE-BP 2, IRE-BP2, IRP2, IRP2AD, NDCAMA)
- Promoter TRE
-
Tag
/ Fusion Protein
- 3x Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1 blast OFF 3xflag IREB2 was a gift from Richard Possemato (Addgene plasmid # 169889 ; http://n2t.net/addgene:169889 ; RRID:Addgene_169889) -
For your References section:
Iron-sulfur cluster deficiency can be sensed by IRP2 and regulates iron homeostasis and sensitivity to ferroptosis independent of IRP1 and FBXL5. Terzi EM, Sviderskiy VO, Alvarez SW, Whiten GC, Possemato R. Sci Adv. 2021 May 26;7(22). pii: 7/22/eabg4302. doi: 10.1126/sciadv.abg4302. Print 2021 May. 10.1126/sciadv.abg4302 PubMed 34039609