Skip to main content
Addgene

pCW57.1 blast OFF 3xflag IREB2
(Plasmid #169889)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169889 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCW57.1-MAT2A
  • Backbone manufacturer
    Addgene 100521
  • Backbone size w/o insert (bp) 7700
  • Total vector size (bp) 10700
  • Vector type
    Mammalian Expression, Lentiviral ; Doxycycline mediated suppression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IREB2
  • Alt name
    Iron Responsive Element Binding Protein 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3000
  • Mutation
    Silent mutations in sgIREB2_1 and sgIREB2_2 target sites
  • Entrez Gene
    IREB2 (a.k.a. ACO3, IRE-BP 2, IRE-BP2, IRP2, IRP2AD, NDCAMA)
  • Promoter TRE
  • Tag / Fusion Protein
    • 3x Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1 blast OFF 3xflag IREB2 was a gift from Richard Possemato (Addgene plasmid # 169889 ; http://n2t.net/addgene:169889 ; RRID:Addgene_169889)

  • For your References section:

    Iron-sulfur cluster deficiency can be sensed by IRP2 and regulates iron homeostasis and sensitivity to ferroptosis independent of IRP1 and FBXL5. Terzi EM, Sviderskiy VO, Alvarez SW, Whiten GC, Possemato R. Sci Adv. 2021 May 26;7(22). pii: 7/22/eabg4302. doi: 10.1126/sciadv.abg4302. Print 2021 May. 10.1126/sciadv.abg4302 PubMed 34039609
Related items:
Commonly requested with: