pegCTNNB1 S45del
(Plasmid
#169844)
-
PurposepegRNA used for installation (via TCC deletion) of the oncogenic S45del in Ctnnb1 in mouse liver.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169844 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmd127
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepegCTNNB1 S45DEL
-
gRNA/shRNA sequenceAGGGTTGCCCTTGCCACTCA
-
SpeciesM. musculus (mouse)
-
GenBank ID
-
Entrez GeneCtnnb1 (a.k.a. Bfc, Catnb, Mesc)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer HU6F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.12.15.422970 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pegCTNNB1 S45del was a gift from Wen Xue (Addgene plasmid # 169844 ; http://n2t.net/addgene:169844 ; RRID:Addgene_169844) -
For your References section:
Improved prime editors enable pathogenic allele correction and cancer modelling in adult mice. Liu P, Liang SQ, Zheng C, Mintzer E, Zhao YG, Ponnienselvan K, Mir A, Sontheimer EJ, Gao G, Flotte TR, Wolfe SA, Xue W. Nat Commun. 2021 Apr 9;12(1):2121. doi: 10.1038/s41467-021-22295-w. 10.1038/s41467-021-22295-w PubMed 33837189