Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFnCas12a_NT
(Plasmid #169838)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169838 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNW33n
  • Backbone size w/o insert (bp) 4447
  • Total vector size (bp) 8350
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FnCas12a
  • gRNA/shRNA sequence
    Cas12a gRNA
  • Species
    Francisella tularensis subsp. novicida
  • GenBank ID
    WP_003040289.1
  • Promoter pXynA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTTGCAAGCAGCAGATTACG
  • 3′ sequencing primer TGCGGCTGTGAAAGAATTCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The gene was cloned from pY002 (pFnCpf1_min) (Plasmid #69975).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFnCas12a_NT was a gift from John van der Oost (Addgene plasmid # 169838 ; http://n2t.net/addgene:169838 ; RRID:Addgene_169838)
  • For your References section:

    Development of a Cas12a-Based Genome Editing Tool for Moderate Thermophiles. Mohanraju P, Mougiakos I, Albers J, Mabuchi M, Fuchs RT, Curcuru JL, van Kranenburg R, Robb GB, van der Oost J. CRISPR J. 2021 Feb;4(1):82-91. doi: 10.1089/crispr.2020.0086. Epub 2021 Feb 4. 10.1089/crispr.2020.0086 PubMed 33538626