LentiCRISPRv2-scr
(Plasmid
#169795)
-
PurposeExpresses Cas9 and guide RNA with untarget sequence generated by scramble of the target sequence of LentiCRISPRv2-ACTB-C1..
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLentiCRISPRv2
-
Backbone manufacturerAddgene Plasmid #52961
- Backbone size w/o insert (bp) 12993
- Total vector size (bp) 13013
-
Modifications to backboneNone
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameScrambled guide RNA
-
gRNA/shRNA sequencecctgggttagagctaccgca
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- 3′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPRv2-scr was a gift from Natsuko Chiba (Addgene plasmid # 169795 ; http://n2t.net/addgene:169795 ; RRID:Addgene_169795) -
For your References section:
Evaluation of site-specific homologous recombination activity of BRCA1 by direct quantitation of gene editing efficiency. Yoshino Y, Endo S, Chen Z, Qi H, Watanabe G, Chiba N. Sci Rep. 2019 Feb 7;9(1):1644. doi: 10.1038/s41598-018-38311-x. 10.1038/s41598-018-38311-x PubMed 30733539