-
PurposeFluorescent reporter for orexin neuropeptides
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169792 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV.hSynapsin1
-
Backbone manufacturerViral Vector Facility - University of Zurich
- Backbone size w/o insert (bp) 4438
- Total vector size (bp) 6481
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameOxLight1
-
SpeciesSynthetic
-
Insert Size (bp)2043
-
GenBank IDMW845970
- Promoter human Synapsin-1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BaMHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gtcgagattaattaactcgagcaggtaag
- 3′ sequencing primer gcaaccaggatttatacaaggaggagaaaat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV.hSynapsin1.OxLight1 was a gift from Tommaso Patriarchi (Addgene plasmid # 169792 ; http://n2t.net/addgene:169792 ; RRID:Addgene_169792) -
For your References section:
A genetically encoded sensor for in vivo imaging of orexin neuropeptides. Duffet L, Kosar S, Panniello M, Viberti B, Bracey E, Zych AD, Radoux-Mergault A, Zhou X, Dernic J, Ravotto L, Tsai YC, Figueiredo M, Tyagarajan SK, Weber B, Stoeber M, Gogolla N, Schmidt MH, Adamantidis AR, Fellin T, Burdakov D, Patriarchi T. Nat Methods. 2022 Feb;19(2):231-241. doi: 10.1038/s41592-021-01390-2. Epub 2022 Feb 10. 10.1038/s41592-021-01390-2 PubMed 35145320