pCAFNF-Venus-Actb
(Plasmid
#169788)
-
PurposeAn actin FRET sensor. Must be expressed with ECFP-actin for FRET.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169788 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAFNF
- Backbone size w/o insert (bp) 6061
- Total vector size (bp) 6658
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameActb
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1128
-
Entrez GeneActb (a.k.a. Actx, E430023M04Rik, beta-actin)
- Promoter CAG
-
Tag
/ Fusion Protein
- Venus (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGTCGCTCGGTACGATTTAAATTGAATTCGCCACCATGgtgagc
- 3′ sequencing primer CAGCCTGCACCTGAGGAGTGCGGCCGCCTAGAAGCACTTGCGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypCAFNF vector is derived from Addgene #13771.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAFNF-Venus-Actb was a gift from Takeshi Imai (Addgene plasmid # 169788 ; http://n2t.net/addgene:169788 ; RRID:Addgene_169788) -
For your References section:
BMPR-2 gates activity-dependent stabilization of primary dendrites during mitral cell remodeling. Aihara S, Fujimoto S, Sakaguchi R, Imai T. Cell Rep. 2021 Jun 22;35(12):109276. doi: 10.1016/j.celrep.2021.109276. 10.1016/j.celrep.2021.109276 PubMed 34161760