PGK plasmid
(Plasmid #169744)

• Purpose: Unregulated "open-loop" PGK promoter plasmid. This plasmid encodes eGFP to report circuit output levels.
• Depositing Lab: Francois St-Pierre
• Publication: Yang et al Nat Commun. 2021 Jul 5;12(1):4132. doi: 10.1038/s41467-021-23889-0.

Backbone

• Vector backbone: pcDNA5/FRT
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4676
• Total vector size (bp): 5396
• Modifications to backbone: The CMV promoter is replaced with a PGK promoter.
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eGFP
• Insert Size (bp): 720
• Promoter: PGK promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cattctgcacgcttcaaaag
• 3′ sequencing primer: ggcaactagaaggcacagtc

Resource Information

• Supplemental Documents:
  • PGK plasmid.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid.