Equalizer-L episome
(Plasmid #169738)

• Purpose: Equalizer-L on an episomal vector. This plasmid encodes eGFP to report circuit output levels. This plasmid also encodes a separate mCherry expression cassette to monitor plasmid dosage.
• Depositing Lab: Francois St-Pierre
• Publication: Yang et al Nat Commun. 2021 Jul 5;12(1):4132. doi: 10.1038/s41467-021-23889-0.

Backbone

• Vector backbone: pCEP4
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 13287
• Total vector size (bp): 15183
• Modifications to backbone: TetO2 site and rabbit beta-globin intron II (bGlob intron) are added to the 5' UTR. Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) is added to the 3' UTR. This plasmid also has a separate mCherry expression cassette: EF1a promoter-mCherry-rbGlob terminator.
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: miR(FF4) target-tetR-P2A-eGFP-miR(FF4) target-miR(FF4)
• Species: Synthetic
• Insert Size (bp): 1896
• Promoter: pCMV-tetO2

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: gcaatagcatcacaaatttc

Resource Information

• Supplemental Documents:
  • Equalizer-L episome.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note the OriP sequence contains a deletion that is also found in Addgene plasmid (pCEP4-CXCR4) which was used as the backbone.