pSUB7
(Plasmid #169698)

• Purpose: Template plasmid for generating C-terminal 6-His epitope tag fusions to bacterial genes by "Lambda red" recombineering.
• Depositing Lab: Nara Figueroa
• Publication: Uzzau et al Proc Natl Acad Sci U S A. 2001 Dec 18;98(26):15264-9. doi: 10.1073/pnas.261348198. Epub 2001 Dec 11.

Backbone

• Vector backbone: pSU311
• Backbone manufacturer: Uzzau et al (PubMed 11742086). Note, pSU311 was initially derived from pGP704 (Miller & Mekalanos; PubMed 2836362)
• Backbone size w/o insert (bp): 1932
• Total vector size (bp): 3440
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): cc118 lambda pir
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 6xHis epitope tag adjacent to FRT-flanked aph (KanR) gene
• Species: E.coli and partially synthetic
• Insert Size (bp): 1508
• Tag / Fusion Protein:
  • 6xHis tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: AGGGATGTAACGCACTGAGA
• 3′ sequencing primer: CCTGCAGATCATCGAGCTCT

Resource Information

• Supplemental Documents:
  • pSUB7.gb
• A portion of this plasmid was derived from a plasmid made by: B. Wanner. The FRT-flanked aph (KanR) cassette was derived from plasmid pKD4 (Datsenko & Wanner, PubMed 10829079)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The 6xHis-FRT-aph-FRT segment is amplified by PCR with primers ending with the sequences 5'...CACCACCATCATCACCATTAG-3' (Forward primer) and 5'...CATATGAATATCCTCCTTAG-3' (Reverse primer) and carrying 40 nt 5' extensions identical to the sequence immediately preceding the stop codon of the targeted gene (Fw primer) and to a region downstream from it (Rv primer). The amplified fragment is used for DNA recombineering in a strain expressing the Lambda Red operon.