pSU312
(Plasmid
#169694)
-
PurposeTemplate plasmid for generating C-terminal 1xFLAG epitope tag fusions to bacterial genes by "Lambda red" recombineering.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSU311
-
Backbone manufacturerUzzau et al (PubMed 11742086). Note, pSU311 was initially derived from pGP704 (Miller & Mekalanos; PubMed 2836362)
- Backbone size w/o insert (bp) 1932
- Total vector size (bp) 3446
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)cc118 lambda pir
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name1xFLAG epitope tag adjacent to FRT-flanked aph (KanR) gene
-
SpeciesE.coli and partially synthetic
-
Insert Size (bp)1514
-
Tag
/ Fusion Protein
- 1xFLAG tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGGGATGTAACGCACTGAGA
- 3′ sequencing primer CCTGCAGATCATCGAGCTCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byB. Wanner. The FRT-flanked aph (KanR) cassette was derived from plasmid pKD4 (Datsenko & Wanner, PubMed 10829079).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The 1xFLAG-FRT-aph-FRT segment is amplified by PCR with primers ending with the sequences 5'...GACTACAAAGATGACGACGAT-3' (Forward primer) and 5'...CATATGAATATCCTCCTTAG-3' (Reverse primer) and carrying 40 nt 5' extensions identical to the sequence immediately preceding the stop codon of the targeted gene (Fw primer) and to a region downstream from it (Rv primer). The amplified fragment is used for DNA recombineering in a strain expressing the Lambda Red operon.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSU312 was a gift from Nara Figueroa (Addgene plasmid # 169694 ; http://n2t.net/addgene:169694 ; RRID:Addgene_169694) -
For your References section:
Epitope tagging of chromosomal genes in Salmonella. Uzzau S, Figueroa-Bossi N, Rubino S, Bossi L. Proc Natl Acad Sci U S A. 2001 Dec 18;98(26):15264-9. doi: 10.1073/pnas.261348198. Epub 2001 Dec 11. 10.1073/pnas.261348198 PubMed 11742086