Skip to main content
Addgene

pTS2322
(Plasmid #169627)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169627 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pVH1002 (pUC57-based)
  • Backbone size w/o insert (bp) 2689
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PCMV-driven expression of SEAP and iRFP and Tactb-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
  • Alt name
    PCMV-SEAP-p2a-iRFP::Tactb-PPGK-IgkSS-Nluc-p2a-mTagBFP2::A3
  • Species
    H. sapiens (human); Synthetic
  • Promoter PhCMV / PPGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer AmpStart
  • 3′ sequencing primer CTGGCACGACAGGTTTCCCGACTGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTS2322 was a gift from Martin Fussenegger (Addgene plasmid # 169627 ; http://n2t.net/addgene:169627 ; RRID:Addgene_169627)
  • For your References section:

    A versatile plasmid architecture for mammalian synthetic biology (VAMSyB). Haellman V, Strittmatter T, Bertschi A, Stucheli P, Fussenegger M. Metab Eng. 2021 Jul;66:41-50. doi: 10.1016/j.ymben.2021.04.003. Epub 2021 Apr 18. 10.1016/j.ymben.2021.04.003 PubMed 33857582