Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p414GPD-3xFLAG-RBM28 dE8
(Plasmid #169268)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169268 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p414GPD
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RBM28 delta E8
  • Species
    H. sapiens (human)
  • Mutation
    deleted Exon 8
  • Entrez Gene
    RBM28 (a.k.a. ANES, NOP4)
  • Promoter GPD
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACGGTAGGTATTGATTGTAATTCTGT
  • 3′ sequencing primer TTCGGTTAGAGCGGATGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p414GPD-3xFLAG-RBM28 dE8 was a gift from Susan Baserga (Addgene plasmid # 169268 ; http://n2t.net/addgene:169268 ; RRID:Addgene_169268)
  • For your References section:

    Biallelic splicing variants in the nucleolar 60S assembly factor RBM28 cause the ribosomopathy ANE syndrome. Bryant CJ, Lorea CF, de Almeida HL Jr, Weinert L, Vedolin L, Pinto E Vairo F, Baserga SJ. Proc Natl Acad Sci U S A. 2021 May 11;118(19). pii: 2017777118. doi: 10.1073/pnas.2017777118. 10.1073/pnas.2017777118 PubMed 33941690