pNVLTv2-pvdIJD-Prha-base
(Plasmid
#169244)
-
PurposeSuicide vector for integrating expression cassette in P. putida (L-rhamnose induction)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169244 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJOE
- Total vector size (bp) 6798
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namerhaRS
-
SpeciesEscherichia coli
- Promoter rhaS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTACGACCAGTCTAAAGAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the 2bp deletion in rTBC0541 (6796bp) as compared to the depositor's sequence does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNVLTv2-pvdIJD-Prha-base was a gift from Brian Pfleger (Addgene plasmid # 169244 ; http://n2t.net/addgene:169244 ; RRID:Addgene_169244) -
For your References section:
Stepwise genetic engineering of Pseudomonas putida enables robust heterologous production of prodigiosin and glidobactin A. Cook TB, Jacobson TB, Venkataraman MV, Hofstetter H, Amador-Noguez D, Thomas MG, Pfleger BF. Metab Eng. 2021 Jun 24;67:112-124. doi: 10.1016/j.ymben.2021.06.004. 10.1016/j.ymben.2021.06.004 PubMed 34175462