-
PurposeSpear-ATAC lentiviral backbone - includes a mU6-sgRNA cassette with flanking Nextera sequencing adapters
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169235 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepMJ114
- Total vector size (bp) 9205
-
Modifications to backboneU6-sgRNA cassette was replaced with Spear-ATAC U6-sgRNA cassette including flanking Nextera sequencing adapters
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin ; BFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemU6-sgRNA
-
gRNA/shRNA sequenceGCGAACTTAATCCCGTGGCAA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSP618 was a gift from William Greenleaf (Addgene plasmid # 169235 ; http://n2t.net/addgene:169235 ; RRID:Addgene_169235) -
For your References section:
High-throughput single-cell chromatin accessibility CRISPR screens enable unbiased identification of regulatory networks in cancer. Pierce SE, Granja JM, Greenleaf WJ. Nat Commun. 2021 May 20;12(1):2969. doi: 10.1038/s41467-021-23213-w. 10.1038/s41467-021-23213-w PubMed 34016988
Map uploaded by the depositor.
