TVBB C-term-mTurquoise2-Hygro
(Plasmid #169225)

• Purpose: Targeting vector backbone to support a knock-in of Linker-mTurquoise2-P2A-Hygro at the C-terminus of a target locus
• Depositing Lab: Hugo Snippert
• Publication: Bollen et al PLoS Biol. 2022 Jan 28;20(1):e3001527. doi: 10.1371/journal.pbio.3001527.

Backbone

• Vector backbone: Minimalistic Amp + ColE1 backbone
• Backbone size w/o insert (bp): 1969
• Total vector size (bp): 3866
• Modifications to backbone: PCR amplified minimalistic backbone segment
• Vector type: Targeting vector backbone
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Grow at 30C for a few hours after overnight growth at 37C to amplify the plasmid copy number
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Double SapI flanked mTurquoise2-P2A-Hygro
• Species: Synthetic
• Insert Size (bp): 1897

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: caaataggggttccgcgcac
• 3′ sequencing primer: ttaccgcctttgagtgagctga

Resource Information

• Supplemental Documents:
  • benchling_export (5).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry