pGEX4T1_GST-PLproCS-MBP
(Plasmid
#169195)
-
PurposeTo express a PLpro substrate (GST-PLproCS-MBP) in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169195 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX-4T-1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGST-PLproCS-MBP
-
Alt nameGST-TLKGGAPTKV-His6-MBP
-
SpeciesSynthetic
- Promoter tac promoter
-
Tags
/ Fusion Proteins
- GST-MBP fusion (PLpro-cleavable)
- His6 (internal tag)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGCTGTTGACAATTAATCATCG
- 3′ sequencing primer ACAAGCTGTGACCGTCTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX4T1_GST-PLproCS-MBP was a gift from John Diffley (Addgene plasmid # 169195 ; http://n2t.net/addgene:169195 ; RRID:Addgene_169195) -
For your References section:
Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of Nsp3 papain-like protease. Lim CT, Tan KW, Wu M, Ulferts R, Armstrong LA, Ozono E, Drury LS, Milligan JC, Zeisner TU, Zeng J, Weissmann F, Canal B, Bineva-Todd G, Howell M, O'Reilly N, Beale R, Kulathu Y, Labib K, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2517-2531. doi: 10.1042/BCJ20210244. 10.1042/BCJ20210244 PubMed 34198325