Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX4T1_GST-PLproCS-MBP
(Plasmid #169195)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169195 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX-4T-1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GST-PLproCS-MBP
  • Alt name
    GST-TLKGGAPTKV-His6-MBP
  • Species
    Synthetic
  • Promoter tac promoter
  • Tags / Fusion Proteins
    • GST-MBP fusion (PLpro-cleavable)
    • His6 (internal tag)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGCTGTTGACAATTAATCATCG
  • 3′ sequencing primer ACAAGCTGTGACCGTCTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX4T1_GST-PLproCS-MBP was a gift from John Diffley (Addgene plasmid # 169195 ; http://n2t.net/addgene:169195 ; RRID:Addgene_169195)
  • For your References section:

    Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of Nsp3 papain-like protease. Lim CT, Tan KW, Wu M, Ulferts R, Armstrong LA, Ozono E, Drury LS, Milligan JC, Zeisner TU, Zeng J, Weissmann F, Canal B, Bineva-Todd G, Howell M, O'Reilly N, Beale R, Kulathu Y, Labib K, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2517-2531. doi: 10.1042/BCJ20210244. 10.1042/BCJ20210244 PubMed 34198325