Skip to main content
Addgene

pK27Sumo_His-SUMO-nsp8 (SARS-CoV-2)
(Plasmid #169187)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169187 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pK27Sumo
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    14His-SUMO-nsp8
  • Alt name
    SARS-CoV-2 nsp8
  • Species
    Synthetic; SARS-CoV-2
  • Mutation
    Codon optimised for E. coli
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter T5
  • Tag / Fusion Protein
    • 14His-SUMO (Ulp1-cleavable) (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGTCAAGCCTGAGACTCACATC
  • 3′ sequencing primer CGTTTCCCGTTGAATATGGCTC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pK27Sumo_His-SUMO-nsp8 (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169187 ; http://n2t.net/addgene:169187 ; RRID:Addgene_169187)

  • For your References section:

    Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp12/7/8 RNA-dependent RNA polymerase. Bertolin AP, Weissmann F, Zeng J, Posse V, Milligan JC, Canal B, Ulferts R, Wu M, Drury LS, Howell M, Beale R, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2425-2443. doi: 10.1042/BCJ20210200. 10.1042/BCJ20210200 PubMed 34198323
Related items:
Commonly requested with: