pEF1α-M2rtTA-T2A-Puro
(Plasmid #169175)

• Purpose: piggyBac co-transfection transposon containing M2rtTA promoter linked with Puromycin resistance gene, through T2A with GSG linker, subcloned between ends of two ITRs. Pairs with #169174
• Depositing Lab: Igor Slukvin
• Publication: Jung et al Cell Rep. 2021 Feb 16;34(7):108758. doi: 10.1016/j.celrep.2021.108758.

Backbone

• Vector backbone: SPB-007
• Backbone manufacturer: Transposagen Bio
• Total vector size (bp): 7741
• Modifications to backbone: M2rtTA promoter linked with Puromycin resistance gene, through T2A, with GSG linker, peptide sequence, is subcloned between ends of the two ITRs
• Vector type: Mammalian Expression ; piggyBac transposon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: M2rtTA-T2A-Puro
• Insert Size (bp): 1419
• Mutation: See Depositor Comments Below
• Promoter: EF1a

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCCTTTTTGAGTTTGGATCTTGG, ACCTTCTCTAGGCACCGGTT
• 3′ sequencing primer: AAAAAGCCATACCAATGGGCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For use in Tet-On inducible expression systems:
The use of two different antibiotic-resistance genes allows for the selection of clones that incorporate the two vectors in a single step. Although all transgene sequences for conditional gene expression could be potentially cloned into a single plasmid, a two plasmid system provides more flexibility and permits the adjustment of the TRE/M2rtTA ratio to optimize hPSC generation with robust DOX-dependent gene expression, while avoiding transgene leakage.

Please note: Plasmid contains an E48K mutation in PuroR. This mutation is not known to affect plasmid function.