Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTRE-SOX17-P2A-Venus-rpEF1a-Zeo
(Plasmid #169174)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169174 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    SPB-007
  • Backbone manufacturer
    Transposagen Bio
  • Total vector size (bp) 9283
  • Modifications to backbone
    SOX17 downstream of TREtight promoter, along with Zeocin resistance gene driven by the EF1α promoter, are subcloned between ends of two ITRs of the transposon vector. SOX17 is linked with Venus through a P2A, with GSG linker, self-cleaving peptide sequence to allow for easy monitoring of transgene expression following addition of doxycycline to cell cultures.
  • Vector type
    Mammalian Expression ; piggyBac transposon
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SOX17-P2A-Venus
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2034
  • GenBank ID
    NM_022454.4
  • Entrez Gene
    SOX17 (a.k.a. VUR3)
  • Promoter pTREtight (tet-inducible promoter)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTGTAACCATTATAAGCTGC, TAGAAGGCACAGTCGAGG
  • 3′ sequencing primer AAAAAGCCATACCAATGGGCC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For use in Tet inducible expression systems:
The use of two different antibiotic-resistance genes allows for the selection of clones that incorporate the two vectors in a single step. Although all transgene sequences for conditional gene expression could be potentially cloned into a single plasmid, a two plasmid system provides more flexibility and permits the adjustment of the TRE/M2rtTA ratio to optimize hPSC generation with robust DOX-dependent gene expression, while avoiding transgene leakage.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRE-SOX17-P2A-Venus-rpEF1a-Zeo was a gift from Igor Slukvin (Addgene plasmid # 169174 ; http://n2t.net/addgene:169174 ; RRID:Addgene_169174)
  • For your References section:

    SOX17 integrates HOXA and arterial programs in hemogenic endothelium to drive definitive lympho-myeloid hematopoiesis. Jung HS, Uenishi G, Park MA, Liu P, Suknuntha K, Raymond M, Choi YJ, Thomson JA, Ong IM, Slukvin II. Cell Rep. 2021 Feb 16;34(7):108758. doi: 10.1016/j.celrep.2021.108758. 10.1016/j.celrep.2021.108758 PubMed 33596423