Skip to main content
Addgene

pBIG1a_3xFlag-6His-nsp15 (SARS-CoV-2)
(Plasmid #169166)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169166 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBIG1a (biGBac)
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Spectinomycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    3xFlag-6His-nsp15
  • Alt name
    FH-nsp15
  • Alt name
    SARS-CoV-2 nsp15
  • Species
    Synthetic; SARS-CoV-2
  • Mutation
    Codon optimised for insect cells (Spodoptera frugiperda)
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • 3xFlag-6His (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAACAGGTTGAACTGCTGATC
  • 3′ sequencing primer GGTGTAGCGTCGTAAGCTAATAC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Baculovirus generation using Tn7 transposition (Bac-to-Bac).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBIG1a_3xFlag-6His-nsp15 (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169166 ; http://n2t.net/addgene:169166 ; RRID:Addgene_169166)

  • For your References section:

    Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp15 endoribonuclease. Canal B, Fujisawa R, McClure AW, Deegan TD, Wu M, Ulferts R, Weissmann F, Drury LS, Bertolin AP, Zeng J, Beale R, Howell M, Labib K, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2465-2479. doi: 10.1042/BCJ20210199. 10.1042/BCJ20210199 PubMed 34198324
Related items:
Commonly requested with: