Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pK27Sumo_His-SUMO-nsp14-nsp10 fusion (SARS-CoV-2)
(Plasmid #169160)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 169160 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pK27SUMO
  • Total vector size (bp) 6307
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    T5 promoter inducible with IPTG
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    14His-SUMO-nsp14-GGSGGS-nsp10
  • Alt name
    nsp14-10 fusion protein
  • Alt name
    SARS-CoV-2 nsp14/nsp10 exonuclease/methyltransferase
  • Species
    Synthetic; SARS-CoV-2
  • Mutation
    Codon optimised for E. coli
  • GenBank ID
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter T5
  • Tags / Fusion Proteins
    • 14His-SUMO (N terminal on backbone)
    • Fusion protein of SARS-CoV-2 nsp14 and nsp10 connected with a GGSGGS linker

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAAGCTGATCAGACCCCTGA
  • 3′ sequencing primer CCAGATGGAGTTCTGAGGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pK27Sumo_His-SUMO-nsp14-nsp10 fusion (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169160 ; http://n2t.net/addgene:169160 ; RRID:Addgene_169160)
  • For your References section:

    Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp14/nsp10 exoribonuclease. Canal B, McClure AW, Curran JF, Wu M, Ulferts R, Weissmann F, Zeng J, Bertolin AP, Milligan JC, Basu S, Drury LS, Deegan TD, Fujisawa R, Roberts EL, Basier C, Labib K, Beale R, Howell M, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2445-2464. doi: 10.1042/BCJ20210198. 10.1042/BCJ20210198 PubMed 34198326