pAAV-DIO-EF1α-mKate2-PDE4D3-Cat
(Plasmid
#169128)
-
PurposeAAV plasmid containing a mKate2 and a truncated PDE4D3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169128 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-DIO-EF1a
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemKate2-PDE4DCatL
-
Alt namemKate2-tagged PDE4D Catalatic domain truncation
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1866
-
Mutationtruncated, Catalatic domain only
-
GenBank IDNM_001165899
- Promoter EF1a
-
Tag
/ Fusion Protein
- mKate2 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer ccagaggttgattatcgataagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
the Boston Children's Hospital viral core made the AAVs for this plasmid, the virus can be requested there.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-DIO-EF1α-mKate2-PDE4D3-Cat was a gift from Georg Nagel (Addgene plasmid # 169128 ; http://n2t.net/addgene:169128 ; RRID:Addgene_169128) -
For your References section:
Hypothalamic dopamine neurons motivate mating through persistent cAMP signalling. Zhang SX, Lutas A, Yang S, Diaz A, Fluhr H, Nagel G, Gao S, Andermann ML. Nature. 2021 Sep;597(7875):245-249. doi: 10.1038/s41586-021-03845-0. Epub 2021 Aug 25. 10.1038/s41586-021-03845-0 PubMed 34433964