pNB208
(Plasmid
#169119)
-
PurposeTESEC expression vector for TrpD from M. tuberculosis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169119 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepNB200
- Backbone size w/o insert (bp) 2400
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametrpD
-
Alt nameRv2192c
-
Alt nameAnthranilate synthase
-
SpeciesMycobacterium tuberculosis H37Rv
-
Insert Size (bp)1113
-
MutationCodon optimized for E. coli
-
Entrez GenetrpD (a.k.a. Rv2192c)
- Promoter pBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GATTAGCGGATCCTACCTGACG
- 3′ sequencing primer AGGCCCAGTCTTTCGACTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.03.26.437171 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNB208 was a gift from Edwin Wintermute (Addgene plasmid # 169119 ; http://n2t.net/addgene:169119 ; RRID:Addgene_169119) -
For your References section:
Low-cost anti-mycobacterial drug discovery using engineered E. coli. Bongaerts N, Edoo Z, Abukar AA, Song X, Sosa-Carrillo S, Haggenmueller S, Savigny J, Gontier S, Lindner AB, Wintermute EH. Nat Commun. 2022 Jul 7;13(1):3905. doi: 10.1038/s41467-022-31570-3. 10.1038/s41467-022-31570-3 PubMed 35798732