HH-gRNA-HDV-Shuttle-Vector
(Plasmid
#169098)
-
PurposeBackbone plasmid to generate HH-gRNA-HDV segment
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169098 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCESAx
- Total vector size (bp) 2819
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHH-gRNAbackbone-HDV
-
Insert Size (bp)216
-
GenBank IDNA
- Promoter NA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer tgacattaacctataaaaata
- 3′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HH-gRNA-HDV-Shuttle-Vector was a gift from Marianne Bronner (Addgene plasmid # 169098 ; http://n2t.net/addgene:169098 ; RRID:Addgene_169098) -
For your References section:
A single-plasmid approach for genome editing coupled with long-term lineage analysis in chick embryos. Gandhi S, Li Y, Tang W, Christensen JB, Urrutia HA, Vieceli FM, Piacentino ML, Bronner ME. Development. 2021 Mar 9. pii: dev.193565. doi: 10.1242/dev.193565. 10.1242/dev.193565 PubMed 33688075