pDRf1-SweetTrac1
(Plasmid
#169083)
-
PurposeExpression of SweetTrac1 biosensor in yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169083 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDRf1
- Backbone size w/o insert (bp) 6939
- Total vector size (bp) 8415
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSweetTrac1
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)1476
- Promoter PMA1
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ACAGCACCAACAGATGTCGT
- 3′ sequencing primer GAAGTGTCAACAACGTATCTACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDRf1-SweetTrac1 was a gift from Lily S Cheung (Addgene plasmid # 169083 ; http://n2t.net/addgene:169083 ; RRID:Addgene_169083) -
For your References section:
Development and quantitative analysis of a biosensor based on the Arabidopsis SWEET1 sugar transporter. Park J, Chavez TM, Guistwhite JA, Gwon S, Frommer WB, Cheung LS. Proc Natl Acad Sci U S A. 2022 Jan 25;119(4). pii: 2119183119. doi: 10.1073/pnas.2119183119. 10.1073/pnas.2119183119 PubMed 35046045