6xHis-TEV-ATG3 (Human autophagy E2-like enzyme)
(Plasmid #169079)

• Purpose: Human ATG3
• Depositing Lab: Sascha Martens
• Publication: Fracchiolla et al J Cell Biol. 2020 Jul 6;219(7). pii: 151802. doi: 10.1083/jcb.201912098.

Backbone

• Vector backbone: pETDuet1
• Backbone manufacturer: Merck
• Backbone size w/o insert (bp): 5420
• Total vector size (bp): 6352
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ATG3
• Alt name: APG3; APG3L; PC3-96; APG3-LIKE
• Species: H. sapiens (human)
• Insert Size (bp): 945
• GenBank ID: 64422 NC_000003.12
• Entrez Gene: ATG3 (a.k.a. APG3, APG3-LIKE, APG3L, PC3-96, hApg3)
• Promoter: T7 lac promoter
• Tag / Fusion Protein:
  • 6X Histidine Tag, TEV cleavage site (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (not destroyed)
• 3′ cloning site: Notl (not destroyed)
• 5′ sequencing primer: ATGCGTCCGGCGTAGA
• 3′ sequencing primer: GATTATGCGGCCGTGTACAA

Resource Information

• Supplemental Documents:
  • pETDuet1-His-TEV hAtg3.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Internal construct reference: SMC-861