pME-ReaChR-citrine
(Plasmid #169045)

• Purpose: Middle entry vector for Gateway cloning that contains a ReaChR fused with citrine gene insert
• Depositing Lab: Paola Arlotta
• Publication: Harris et al Dev Cell. 2020 Jun 8;53(5):577-588.e7. doi: 10.1016/j.devcel.2020.05.009.

Backbone

• Vector backbone: pENTR/D-TOPO
• Backbone manufacturer: ThermoFischer
• Backbone size w/o insert (bp): 2709
• Total vector size (bp): 4469
• Vector type: Gateway Entry Cloning Vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ReaChR-citrine
• Species: Synthetic
• Insert Size (bp): 1776
• GenBank ID: KF448069
• Tag / Fusion Protein:
  • citrine (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GTAAAACGACGGCCAG
• 3′ sequencing primer: CATCAGAGATTTTGAGACAC

Resource Information

• Supplemental Documents:
  • pME-ReaChR-Citrine.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene 50956

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry