Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pME-ReaChR-citrine
(Plasmid #169045)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169045 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pENTR/D-TOPO
  • Backbone manufacturer
    ThermoFischer
  • Backbone size w/o insert (bp) 2709
  • Total vector size (bp) 4469
  • Vector type
    Gateway Entry Cloning Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ReaChR-citrine
  • Species
    Synthetic
  • Insert Size (bp)
    1776
  • GenBank ID
    KF448069
  • Tag / Fusion Protein
    • citrine (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GTAAAACGACGGCCAG
  • 3′ sequencing primer CATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene 50956

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pME-ReaChR-citrine was a gift from Paola Arlotta (Addgene plasmid # 169045 ; http://n2t.net/addgene:169045 ; RRID:Addgene_169045)
  • For your References section:

    Long-Range Optogenetic Control of Axon Guidance Overcomes Developmental Boundaries and Defects. Harris JM, Wang AY, Boulanger-Weill J, Santoriello C, Foianini S, Lichtman JW, Zon LI, Arlotta P. Dev Cell. 2020 Jun 8;53(5):577-588.e7. doi: 10.1016/j.devcel.2020.05.009. 10.1016/j.devcel.2020.05.009 PubMed 32516597