pDestTol2CG2-mnx1:mCherry-PA-Rac1
(Plasmid #169044)

• Purpose: Destination transgenesis vector for expressing mCherry fused with an optimized photoactivatable Rac1 protein in zebrafish spinal motor neurons using 3 tandem repeats of the mnx1 enhancer.
• Depositing Lab: Paola Arlotta
• Publication: Harris et al Dev Cell. 2020 Jun 8;53(5):577-588.e7. doi: 10.1016/j.devcel.2020.05.009.

Backbone

• Vector backbone: pDestTol2CG2
• Backbone manufacturer: Chi-Bin Chien lab
• Backbone size w/o insert (bp): 7796
• Total vector size (bp): 8730
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PA-Rac-1
• Alt name: Photoactivatable Rac1
• Alt name: LOV(Leu404-Leu546)-(L514K-L531K)-Rac1(Ile4)-Q61L/E91H/N92H
• Species: H. sapiens (human); Avena sativa (oat)
• Insert Size (bp): 1005
• Mutation: Rac1 starts at I4 and contains mutations Q61L, E91H and N92H (results in the photoactivatable analogue of Rac1). L514K, L531K mutations in LOV domain reduce background activation.
• GenBank ID: AB451363
• Entrez Gene: RAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)
• Promoter: 3xMnx1
• Tags / Fusion Proteins:
  • Fused with mCherry (N terminal on backbone)
  • 6X His (N terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GTTTGTACAAAAAAGCAGGC
• 3′ sequencing primer: CCACTTTGTACAAGAAAGCTGGGT

Resource Information

• Supplemental Documents:
  • 3xmnx1-mCherry-PA-Rac.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene 22027

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry