p5E-3x125bp-mnx1
(Plasmid #169043)

• Purpose: 5' entry vector for Gateway cloning for expression in spinal motor neurons using 3 tandem repeats of the zebrafish mnx1 enhancer.
• Depositing Lab: Paola Arlotta
• Publication: Harris et al Dev Cell. 2020 Jun 8;53(5):577-588.e7. doi: 10.1016/j.devcel.2020.05.009.

Backbone

• Vector backbone: p5E
• Backbone manufacturer: Chi-Bin Chien lab
• Backbone size w/o insert (bp): 2663
• Total vector size (bp): 3091
• Vector type: Gateway Entry Cloning Vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Mnx1 enhancer (3x)
• Alt name: Three tandem repeats of zebrafish mnx1 enhancer
• Species: D. rerio (zebrafish)
• Insert Size (bp): 411
• Entrez Gene: mnx1 (a.k.a. hlxb, hlxb9, zgc:112174)
• Promoter: 3xMnx1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: HindIII (destroyed during cloning)
• 5′ sequencing primer: GTAAAACGACGGCCAG
• 3′ sequencing primer: CATCAGAGATTTTGAGACAC

Resource Information

• Supplemental Documents:
  • p5'-mnx1-3x125bp.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See the following paper for cloning details of the 3x 125bp mnx1 enhancer: Zelenchuk, T.A. and Brusés, J.L. (2011), In Vivo labeling of zebrafish motor neurons using an mnx1 enhancer and Gal4/UAS. Genesis, 49: 546-554. https://doi.org/10.1002/dvg.20766