GFP-Rab7Q67L
(Plasmid #169038)

• Purpose: Express human constitutively active form of Rab7a(Q67L) in mammalian cells
• Depositing Lab: Gia Voeltz
• Publication: Wu et al Dev Cell. 2021 Jan 11;56(1):52-66.e7. doi: 10.1016/j.devcel.2020.12.014.

Backbone

• Vector backbone: pAcGFP1-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 5345
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rab7a
• Species: H. sapiens (human)
• Insert Size (bp): 624
• Mutation: Q67L
• Entrez Gene: RAB7A (a.k.a. CMT2B, PRO2706, RAB7)
• Promoter: CMV
• Tag / Fusion Protein:
  • acGFP1 (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CAAATGTGGTATGGCTGATT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry