Rtn3LΔ6LIR-mNeonGreen
(Plasmid #169036)

• Purpose: Express human Rtn3L with 6x LC3-interacting regions mutated in mammalian cells
• Depositing Lab: Gia Voeltz
• Publication: Wu et al Dev Cell. 2021 Jan 11;56(1):52-66.e7. doi: 10.1016/j.devcel.2020.12.014.

Backbone

• Vector backbone: mNeonGreen-N1
• Backbone manufacturer: Allele Biotechnology
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 8269
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rtn3L
• Alt name: Rtn3b
• Species: H. sapiens (human)
• Insert Size (bp): 3040
• Mutation: Changed following LC3-interacting regions of Rtn3L-mNeonGreen: FTLL, YSKV, FEVI, WDLV, FEEL, and YDIL to ATLA, ASKA, AEVA, ADLA, AEEA, and ADIA.
• GenBank ID: NM_201428.3
• Entrez Gene: RTN3 (a.k.a. ASYIP, HAP, NSPL2, NSPLII, RTN3-A1)
• Promoter: CMV
• Tag / Fusion Protein:
  • mNeonGreen (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CAAATGTGGTATGGCTGATT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry