Rtn3S-GFP
(Plasmid #169035)

• Purpose: Express human Rtn3S in mammalian cells
• Depositing Lab: Gia Voeltz
• Publication: Wu et al Dev Cell. 2021 Jan 11;56(1):52-66.e7. doi: 10.1016/j.devcel.2020.12.014.

Backbone

• Vector backbone: pAcGFP1-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 7726
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rtn3S
• Alt name: Rtn3a
• Species: H. sapiens (human)
• Insert Size (bp): 712
• GenBank ID: NM_006054.4
• Entrez Gene: RTN3 (a.k.a. ASYIP, HAP, NSPL2, NSPLII, RTN3-A1)
• Promoter: CMV
• Tag / Fusion Protein:
  • acGFP1 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CAAATGTGGTATGGCTGATT

Resource Information

• Supplemental Documents:
  • Rtn3S-GFP.xdna.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry