Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFL GST-UBXN2A
(Plasmid #169016)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169016 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFL
  • Backbone size w/o insert (bp) 5385
  • Total vector size (bp) 6858
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UBXN2A
  • Alt name
    UBXD4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    777
  • GenBank ID
    NP_859064.2
  • Promoter polyhedrin promoter
  • Tag / Fusion Protein
    • GST (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TAAAATGATAACCATCTCGC
  • 3′ sequencing primer GAGGTTTTACTTGCTTTAAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFL GST-UBXN2A was a gift from Hemmo Meyer (Addgene plasmid # 169016 ; http://n2t.net/addgene:169016 ; RRID:Addgene_169016)
  • For your References section:

    Protein Phosphatase-1 Complex Disassembly by p97 is Initiated through Multivalent Recognition of Catalytic and Regulatory Subunits by the p97 SEP-domain Adapters. Kracht M, van den Boom J, Seiler J, Kroning A, Kaschani F, Kaiser M, Meyer H. J Mol Biol. 2020 Nov 20;432(23):6061-6074. doi: 10.1016/j.jmb.2020.10.001. Epub 2020 Oct 12. 10.1016/j.jmb.2020.10.001 PubMed 33058883