pB[vasa-Cas9 PUb-ZsGreen]
(Plasmid
#169012)
-
PurposeFor germline transformation. Expresses Cas9 in germ cells and ZsGreen marker in all cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169012 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepB[PUb-ZsGreen]
- Total vector size (bp) 7626
-
Vector typeInsect Expression ; piggyBac
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4142
- Promoter Drosophila melanogaster vasa
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site PspOMI (not destroyed)
- 5′ sequencing primer CGCCAAAACCAAATCTGCC
- 3′ sequencing primer GCTTGTCAATGCGGTAAGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byvasa-Cas9 gene obtained from the Drosophila Genomics Resource Center, plasmid #1340
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB[vasa-Cas9 PUb-ZsGreen] was a gift from Max Scott (Addgene plasmid # 169012 ; http://n2t.net/addgene:169012 ; RRID:Addgene_169012) -
For your References section:
Genetically Encoded CRISPR Components Yield Efficient Gene Editing in the Invasive Pest Drosophila suzukii. Kandul NP, Belikoff EJ, Liu J, Buchman A, Li F, Yamamoto A, Yang T, Shriner I, Scott MJ, Akbari OS. CRISPR J. 2021 Oct;4(5):739-751. doi: 10.1089/crispr.2021.0032. 10.1089/crispr.2021.0032 PubMed 34661429