cpLOV2-V7
(Plasmid
#168993)
-
Purposecircularly permuted LOV2 variant-V7
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168993 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemCherry2-N1
- Backbone size w/o insert (bp) 4728
- Total vector size (bp) 5166
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecpLOV2-V7
-
Insert Size (bp)438
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CMVf: CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cpLOV2-V7 was a gift from Yubin Zhou (Addgene plasmid # 168993 ; http://n2t.net/addgene:168993 ; RRID:Addgene_168993) -
For your References section:
Circularly permuted LOV2 as a modular photoswitch for optogenetic engineering. He L, Tan P, Zhu L, Huang K, Nguyen NT, Wang R, Guo L, Li L, Yang Y, Huang Z, Huang Y, Han G, Wang J, Zhou Y. Nat Chem Biol. 2021 Aug;17(8):915-923. doi: 10.1038/s41589-021-00792-9. Epub 2021 May 6. 10.1038/s41589-021-00792-9 PubMed 33958793