pInducer10-UBC9-sh1
(Plasmid
#168986)
-
PurposeExpresses RFP cDNA and UBC9 shRNA 1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168986 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepInducer-10
- Backbone size w/o insert (bp) 13217
- Total vector size (bp) 13261
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUbiquitin Conjugating Enzyme 9
-
Alt nameUBC9
-
gRNA/shRNA sequencettggcagtaaatcgtgtaggcc
-
GenBank IDXM_035021873.1 XM_035021873.1
-
Entrez GeneUBE2I (a.k.a. C358B7.1, P18, UBC9)
- Promoter Ubc promoter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cggcttccacttcgtggaccacag
- 3′ sequencing primer ctgatccttccgcccggacgctcag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pInducer10-UBC9-sh1 was a gift from Ji Luo (Addgene plasmid # 168986 ; http://n2t.net/addgene:168986 ; RRID:Addgene_168986) -
For your References section:
Oncogenesis driven by the Ras/Raf pathway requires the SUMO E2 ligase Ubc9. Yu B, Swatkoski S, Holly A, Lee LC, Giroux V, Lee CS, Hsu D, Smith JL, Yuen G, Yue J, Ann DK, Simpson RM, Creighton CJ, Figg WD, Gucek M, Luo J. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):E1724-33. doi: 10.1073/pnas.1415569112. Epub 2015 Mar 24. 10.1073/pnas.1415569112 PubMed 25805818