PB_iNEUROD1_P2A_GFP_Puro
(Plasmid
#168803)
-
PurposePiggyBac transposon construct with doxycycline inducible NEUROD1 + GFP expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168803 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePB-TRE
- Backbone size w/o insert (bp) 7527
- Total vector size (bp) 1854
-
Vector typeMammalian Expression, Synthetic Biology ; PiggyBac
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNEUROD1
-
Alt nameNEUROD1-P2A-GFP
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1847
-
Entrez GeneNEUROD1 (a.k.a. BETA2, BHF-1, MODY6, NEUROD, T2D, bHLHa3)
- Promoter TRE
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagatcgcctggagcaattc
- 3′ sequencing primer ttgtctccttccgtgtttca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB_iNEUROD1_P2A_GFP_Puro was a gift from Prashant Mali (Addgene plasmid # 168803 ; http://n2t.net/addgene:168803 ; RRID:Addgene_168803) -
For your References section:
Programmatic introduction of parenchymal cell types into blood vessel organoids. Dailamy A, Parekh U, Katrekar D, Kumar A, McDonald D, Moreno A, Bagheri P, Ng TN, Mali P. Stem Cell Reports. 2021 Sep 8. pii: S2213-6711(21)00432-X. doi: 10.1016/j.stemcr.2021.08.014. 10.1016/j.stemcr.2021.08.014 PubMed 34559998