Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGem-LP2-loxP-bar-lox2272-71
(Plasmid #168786)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168786 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEM
  • Backbone size w/o insert (bp) 3033
  • Total vector size (bp) 6560
  • Vector type
    Cre/Lox, Synthetic Biology
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    bar
  • Alt name
    Glufosinate/basta-resistance
  • Species
    Synthetic; Streptomyces hygroscopicus
  • Insert Size (bp)
    939

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    IS1 Homology arm 1
  • Species
    Aspergillus nidulans
  • Insert Size (bp)
    1040

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    IS1 Homology arm 2
  • Species
    Aspergillus nidulans
  • Insert Size (bp)
    1033

Cloning Information for Gene/Insert 3

Gene/Insert 4

  • Gene/Insert name
    loxP
  • Species
    Synthetic
  • Insert Size (bp)
    34

Cloning Information for Gene/Insert 4

Gene/Insert 5

  • Gene/Insert name
    lox2272-71
  • Species
    Synthetic
  • Insert Size (bp)
    34

Cloning Information for Gene/Insert 5

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmII (destroyed during cloning)
  • 3′ cloning site AatII (destroyed during cloning)
  • 5′ sequencing primer AATGCTTCGAGGTCCTGTATTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vector used to create Aspergillus nidulans parental strains with LP2 by polyethylene glycol (PEG)-calcium-based transformation with NotI linearized vector pGemLP2-loxP-bar-Lox2272-71 containing 1 kb homology regions at 5′ and 3′ of the floxed bar to facilitate homologous recombination in IS1 locus of A. nidulans. Colonies are selected for resistance to glufosinate extracted from Basta.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGem-LP2-loxP-bar-lox2272-71 was a gift from Yit Heng Chooi (Addgene plasmid # 168786 ; http://n2t.net/addgene:168786 ; RRID:Addgene_168786)
  • For your References section:

    Cre/lox-Mediated Chromosomal Integration of Biosynthetic Gene Clusters for Heterologous Expression in Aspergillus nidulans. Roux I, Chooi YH. ACS Synth Biol. 2022 Feb 16. doi: 10.1021/acssynbio.1c00458. 10.1021/acssynbio.1c00458 PubMed 35168324